Transcript: Human XM_017016705.1

PREDICTED: Homo sapiens ADAM metallopeptidase domain 12 (ADAM12), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADAM12 (8038)
Length:
7934
CDS:
785..3046

Additional Resources:

NCBI RefSeq record:
XM_017016705.1
NBCI Gene record:
ADAM12 (8038)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016705.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371220 GCGAGATGAGAGATGCTAAAT pLKO_005 2034 CDS 100% 13.200 18.480 N ADAM12 n/a
2 TRCN0000047035 GCTGCCGGATTTGTGGTTTAT pLKO.1 2480 CDS 100% 13.200 18.480 N ADAM12 n/a
3 TRCN0000047036 CCTCGCAAATCCCATGACAAT pLKO.1 1202 CDS 100% 4.950 6.930 N ADAM12 n/a
4 TRCN0000371169 TCCACCCACACCGCCTATATT pLKO_005 3020 CDS 100% 15.000 12.000 N ADAM12 n/a
5 TRCN0000047033 GCCATGTTTCACAAGGTCTTT pLKO.1 4421 3UTR 100% 4.950 3.465 N ADAM12 n/a
6 TRCN0000047037 GCCTGAATCGTCAATGTCAAA pLKO.1 2247 CDS 100% 4.950 3.465 N ADAM12 n/a
7 TRCN0000371168 GAGACCCTCAAGGCAACTAAG pLKO_005 938 CDS 100% 10.800 6.480 N ADAM12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016705.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.