Transcript: Human XM_017016752.1

PREDICTED: Homo sapiens synaptotagmin 15 (SYT15), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SYT15 (83849)
Length:
1370
CDS:
154..1326

Additional Resources:

NCBI RefSeq record:
XM_017016752.1
NBCI Gene record:
SYT15 (83849)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016752.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380085 TGTGGTTCTCGGTGGAATATG pLKO_005 605 CDS 100% 13.200 6.600 Y SYT15 n/a
2 TRCN0000380616 CCATCAACCCTGTGTACAATG pLKO_005 1172 CDS 100% 10.800 5.400 Y SYT15 n/a
3 TRCN0000381499 GAGGCATTGTCAGTGTGTTTG pLKO_005 1085 CDS 100% 10.800 5.400 Y SYT15 n/a
4 TRCN0000059931 GCTGTGGTTCTCGGTGGAATA pLKO.1 603 CDS 100% 10.800 5.400 Y SYT15 n/a
5 TRCN0000059932 AGAGGCATTGTCAGTGTGTTT pLKO.1 1084 CDS 100% 4.950 2.475 Y SYT15 n/a
6 TRCN0000380084 ATGAACCACAACAAGTTTGTC pLKO_005 1120 CDS 100% 4.950 2.475 Y SYT15 n/a
7 TRCN0000381456 CATCAACCCAGAGCTGTACAA pLKO_005 531 CDS 100% 4.950 2.475 Y SYT15 n/a
8 TRCN0000379558 AGGTGTCCAGCAAGACCATCA pLKO_005 803 CDS 100% 4.050 2.025 Y SYT15 n/a
9 TRCN0000382517 CAATCCAAGACCAAACGCAAA pLKO_005 745 CDS 100% 4.050 2.025 Y SYT15 n/a
10 TRCN0000382172 GGTGCTGAAGTTCTCCGTCTA pLKO_005 831 CDS 100% 4.050 2.025 Y SYT15 n/a
11 TRCN0000381073 TTGAAGAATGAGACCCTAGTG pLKO_005 904 CDS 100% 4.050 2.025 Y SYT15 n/a
12 TRCN0000059929 CCAATCCAAGACCAAACGCAA pLKO.1 744 CDS 100% 2.640 1.320 Y SYT15 n/a
13 TRCN0000059930 CCCTGTGTACAATGAGACCTT pLKO.1 1179 CDS 100% 2.640 1.320 Y SYT15 n/a
14 TRCN0000059928 CCCTTGAAGAATGAGACCCTA pLKO.1 901 CDS 100% 2.640 1.320 Y SYT15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016752.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.