Transcript: Human XM_017016842.1

PREDICTED: Homo sapiens F-box DNA helicase 1 (FBH1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FBH1 (84893)
Length:
4880
CDS:
1232..4567

Additional Resources:

NCBI RefSeq record:
XM_017016842.1
NBCI Gene record:
FBH1 (84893)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016842.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051665 CGCTGAAATGAGACGGTTTAA pLKO.1 1378 CDS 100% 13.200 18.480 N FBH1 n/a
2 TRCN0000439415 CCTCAACGCTGGTCAAGTATG pLKO_005 2793 CDS 100% 10.800 15.120 N FBH1 n/a
3 TRCN0000413572 TTCGGTCAAAGATGGACAAAC pLKO_005 1466 CDS 100% 10.800 15.120 N FBH1 n/a
4 TRCN0000051666 CGTGCCTATTTGGTGTAAGAA pLKO.1 3109 CDS 100% 5.625 4.500 N FBH1 n/a
5 TRCN0000438287 ACCCGCACCAGCAGATCTATA pLKO_005 3399 CDS 100% 13.200 9.240 N FBH1 n/a
6 TRCN0000051663 CCTCGTCATTAAAGACAAATT pLKO.1 3787 CDS 100% 13.200 9.240 N FBH1 n/a
7 TRCN0000432390 GCTTATGTGGGAGCTACTATC pLKO_005 3509 CDS 100% 10.800 7.560 N FBH1 n/a
8 TRCN0000051667 GCTGATTCTGAATCACAAGAT pLKO.1 2722 CDS 100% 4.950 3.465 N FBH1 n/a
9 TRCN0000051664 CCTGACTCATACTATGGGCTT pLKO.1 1961 CDS 100% 2.160 1.512 N FBH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016842.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16047 pDONR223 0% 70.2% 70.2% None 1_942del;2747_2797del n/a
2 ccsbBroad304_16047 pLX_304 0% 70.2% 70.2% V5 1_942del;2747_2797del n/a
Download CSV