Transcript: Human XM_017016845.1

PREDICTED: Homo sapiens F-box DNA helicase 1 (FBH1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FBH1 (84893)
Length:
4006
CDS:
514..3693

Additional Resources:

NCBI RefSeq record:
XM_017016845.1
NBCI Gene record:
FBH1 (84893)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016845.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000439415 CCTCAACGCTGGTCAAGTATG pLKO_005 1919 CDS 100% 10.800 15.120 N FBH1 n/a
2 TRCN0000051666 CGTGCCTATTTGGTGTAAGAA pLKO.1 2235 CDS 100% 5.625 4.500 N FBH1 n/a
3 TRCN0000438287 ACCCGCACCAGCAGATCTATA pLKO_005 2525 CDS 100% 13.200 9.240 N FBH1 n/a
4 TRCN0000051663 CCTCGTCATTAAAGACAAATT pLKO.1 2913 CDS 100% 13.200 9.240 N FBH1 n/a
5 TRCN0000432390 GCTTATGTGGGAGCTACTATC pLKO_005 2635 CDS 100% 10.800 7.560 N FBH1 n/a
6 TRCN0000051667 GCTGATTCTGAATCACAAGAT pLKO.1 1848 CDS 100% 4.950 3.465 N FBH1 n/a
7 TRCN0000051664 CCTGACTCATACTATGGGCTT pLKO.1 1087 CDS 100% 2.160 1.512 N FBH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016845.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16047 pDONR223 0% 73.6% 73.6% None 1_786del;2591_2641del n/a
2 ccsbBroad304_16047 pLX_304 0% 73.6% 73.6% V5 1_786del;2591_2641del n/a
Download CSV