Transcript: Human XM_017016851.2

PREDICTED: Homo sapiens ATPase family AAA domain containing 1 (ATAD1), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATAD1 (84896)
Length:
2705
CDS:
43..636

Additional Resources:

NCBI RefSeq record:
XM_017016851.2
NBCI Gene record:
ATAD1 (84896)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016851.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233058 ATGTTACTTGGAGTGATATAG pLKO_005 302 CDS 100% 13.200 9.240 N ATAD1 n/a
2 TRCN0000101557 GCATGTTACTTGGAGTGATAT pLKO.1 300 CDS 100% 13.200 9.240 N Atad1 n/a
3 TRCN0000148038 GCATGTTACTTGGAGTGATAT pLKO.1 300 CDS 100% 13.200 9.240 N ATAD1 n/a
4 TRCN0000308412 GCATGTTACTTGGAGTGATAT pLKO_005 300 CDS 100% 13.200 9.240 N Atad1 n/a
5 TRCN0000233057 TTGGTGCAGTGACATACTTTA pLKO_005 119 CDS 100% 13.200 9.240 N ATAD1 n/a
6 TRCN0000146875 CAAATGGATGGTAGATGCAAT pLKO.1 144 CDS 100% 4.950 3.465 N ATAD1 n/a
7 TRCN0000147588 GATGTCATTACGGATCTGAAA pLKO.1 334 CDS 100% 4.950 3.465 N ATAD1 n/a
8 TRCN0000233059 GAAGCAGGCTGTCGATTTATT pLKO_005 487 CDS 100% 15.000 9.000 N ATAD1 n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2608 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016851.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.