Transcript: Human XM_017016912.2

PREDICTED: Homo sapiens leucine rich glioma inactivated 1 (LGI1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LGI1 (9211)
Length:
1361
CDS:
259..990

Additional Resources:

NCBI RefSeq record:
XM_017016912.2
NBCI Gene record:
LGI1 (9211)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016912.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372839 TAGTCTCTCCTCGAAGGATTT pLKO_005 750 CDS 100% 10.800 15.120 N LGI1 n/a
2 TRCN0000191940 GCAGTGAAGATGTGTAAATAA pLKO.1 1230 3UTR 100% 15.000 10.500 N Lgi1 n/a
3 TRCN0000378822 CACCGTTCCTCCTGATGTTAT pLKO_005 447 CDS 100% 13.200 9.240 N LGI1 n/a
4 TRCN0000063923 CCAGAATACAAGAAGCGCAAA pLKO.1 724 CDS 100% 4.050 2.835 N LGI1 n/a
5 TRCN0000063925 GCCTTATCAATCATTGTCCAT pLKO.1 810 CDS 100% 2.640 1.848 N LGI1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016912.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02107 pDONR223 100% 42.4% 42% None (many diffs) n/a
2 ccsbBroad304_02107 pLX_304 0% 42.4% 42% V5 (many diffs) n/a
Download CSV