Transcript: Human XM_017017182.2

PREDICTED: Homo sapiens FAT atypical cadherin 3 (FAT3), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAT3 (120114)
Length:
19234
CDS:
132..13874

Additional Resources:

NCBI RefSeq record:
XM_017017182.2
NBCI Gene record:
FAT3 (120114)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017182.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038104 GCCCTGCTTAACAAGAGCAAT pLKO.1 12795 CDS 100% 4.950 6.930 N FAT3 n/a
2 TRCN0000038108 GCTGTGTTTGAGACTATCTTA pLKO.1 5856 CDS 100% 5.625 4.500 N FAT3 n/a
3 TRCN0000339000 CTCCTTAAGTGGTCGATTAAA pLKO_005 770 CDS 100% 15.000 10.500 N FAT3 n/a
4 TRCN0000338932 GGGAATCCAAAGCCAATTATT pLKO_005 2812 CDS 100% 15.000 10.500 N FAT3 n/a
5 TRCN0000338931 TAATAGACAGGGACCATATTT pLKO_005 2285 CDS 100% 15.000 10.500 N FAT3 n/a
6 TRCN0000338998 TGTCGTGGTTGCTATAGTAAA pLKO_005 1307 CDS 100% 13.200 9.240 N FAT3 n/a
7 TRCN0000338929 TTATTTCACCCACTAAGTTAT pLKO_005 14146 3UTR 100% 13.200 9.240 N FAT3 n/a
8 TRCN0000038106 CCAGCAAGTTTCTCACACTTA pLKO.1 10787 CDS 100% 4.950 3.465 N FAT3 n/a
9 TRCN0000038107 CGCCTCCACATTGAATGGATT pLKO.1 4161 CDS 100% 4.950 3.465 N FAT3 n/a
10 TRCN0000038105 CCTGTGTTTGATAAGCCCTTT pLKO.1 6750 CDS 100% 4.050 2.835 N FAT3 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 18682 3UTR 100% 4.950 2.475 Y KAAG1 n/a
12 TRCN0000097310 GCAGAGAAACTACTCATTAAA pLKO.1 2208 CDS 100% 15.000 10.500 N Fat3 n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 15429 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 15429 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017182.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.