Transcript: Human XM_017017237.1

PREDICTED: Homo sapiens Rho GTPase activating protein 42 (ARHGAP42), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARHGAP42 (143872)
Length:
8214
CDS:
612..3074

Additional Resources:

NCBI RefSeq record:
XM_017017237.1
NBCI Gene record:
ARHGAP42 (143872)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017237.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336590 AGTGGAACCAGGATGGTTAAA pLKO_005 2996 CDS 100% 13.200 18.480 N ARHGAP42 n/a
2 TRCN0000336648 GGTATCCATGGTAACGAATAA pLKO_005 3104 3UTR 100% 13.200 18.480 N ARHGAP42 n/a
3 TRCN0000350822 TGTTACTAGCTCACCGGAAAT pLKO_005 1391 CDS 100% 10.800 15.120 N ARHGAP42 n/a
4 TRCN0000130104 CGAGTATTCATCAACTGGTCT pLKO.1 6839 3UTR 100% 2.640 3.696 N n/a
5 TRCN0000128493 GTATTCATCAACTGGTCTCAA pLKO.1 6842 3UTR 100% 4.950 3.960 N n/a
6 TRCN0000129252 CACATTCACTGTATCCCTCAT pLKO.1 6872 3UTR 100% 4.050 3.240 N n/a
7 TRCN0000336649 GATGGGAAGGAACCGATTTAT pLKO_005 1557 CDS 100% 15.000 10.500 N ARHGAP42 n/a
8 TRCN0000423750 GCCAGTTCCACTTGGTAATAA pLKO_005 6923 3UTR 100% 15.000 10.500 N n/a
9 TRCN0000336589 CCAGGAATTTGCACCGTATAA pLKO_005 1103 CDS 100% 13.200 9.240 N ARHGAP42 n/a
10 TRCN0000415939 TTCATTTACTGCCATCATAAA pLKO_005 7287 3UTR 100% 13.200 9.240 N n/a
11 TRCN0000129094 CCTGTTGATTCGCAGATGTAA pLKO.1 6815 3UTR 100% 5.625 3.938 N n/a
12 TRCN0000128240 GTCTCAATTTCCTGAACACAT pLKO.1 6856 3UTR 100% 4.950 3.465 N n/a
13 TRCN0000128390 GCTATTTAACTTTGCCTCCTA pLKO.1 6713 3UTR 100% 2.640 1.848 N n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017237.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.