Transcript: Human XM_017017363.1

PREDICTED: Homo sapiens RAS related 2 (RRAS2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RRAS2 (22800)
Length:
2011
CDS:
46..594

Additional Resources:

NCBI RefSeq record:
XM_017017363.1
NBCI Gene record:
RRAS2 (22800)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017363.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047724 CGTGATGAGTTCCCAATGATT pLKO.1 328 CDS 100% 5.625 4.500 N RRAS2 n/a
2 TRCN0000299286 CGTGATGAGTTCCCAATGATT pLKO_005 328 CDS 100% 5.625 4.500 N RRAS2 n/a
3 TRCN0000047725 CCATTGAAGATTCTTACACAA pLKO.1 116 CDS 100% 4.950 3.960 N RRAS2 n/a
4 TRCN0000299358 CCATTGAAGATTCTTACACAA pLKO_005 116 CDS 100% 4.950 3.960 N RRAS2 n/a
5 TRCN0000047723 CCATGAACTTGTCCGGGTTAT pLKO.1 483 CDS 100% 10.800 7.560 N RRAS2 n/a
6 TRCN0000331646 CCATGAACTTGTCCGGGTTAT pLKO_005 483 CDS 100% 10.800 7.560 N RRAS2 n/a
7 TRCN0000047726 GCAAAGATTAGGATGAATGTA pLKO.1 451 CDS 100% 5.625 3.938 N RRAS2 n/a
8 TRCN0000299285 GCAAAGATTAGGATGAATGTA pLKO_005 451 CDS 100% 5.625 3.938 N RRAS2 n/a
9 TRCN0000047727 CTCAGAGTAAAGGATCGTGAT pLKO.1 313 CDS 100% 4.050 2.835 N RRAS2 n/a
10 TRCN0000299287 CTCAGAGTAAAGGATCGTGAT pLKO_005 313 CDS 100% 4.050 2.835 N RRAS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017363.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.