Transcript: Human XM_017017628.1

PREDICTED: Homo sapiens transient receptor potential cation channel subfamily M member 5 (TRPM5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRPM5 (29850)
Length:
4257
CDS:
43..3603

Additional Resources:

NCBI RefSeq record:
XM_017017628.1
NBCI Gene record:
TRPM5 (29850)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017628.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044873 CCTCGTCTATACCAACCTCAT pLKO.1 2070 CDS 100% 4.050 5.670 N TRPM5 n/a
2 TRCN0000044877 CTGATCCATATCTTTGCCATA pLKO.1 2641 CDS 100% 4.050 5.670 N TRPM5 n/a
3 TRCN0000044875 CCCTCTACTTCTGGGTCTTTA pLKO.1 2405 CDS 100% 13.200 9.240 N TRPM5 n/a
4 TRCN0000431506 CATCGTGGTAGAGCGCATGAT pLKO_005 2685 CDS 100% 4.950 3.465 N TRPM5 n/a
5 TRCN0000044874 GCATTTCTCTTGGGAGGACAT pLKO.1 963 CDS 100% 4.050 2.835 N TRPM5 n/a
6 TRCN0000044876 GTGAAGAAGTTCACACTGTAT pLKO.1 2482 CDS 100% 0.495 0.347 N TRPM5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017628.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.