Transcript: Human XM_017017657.1

PREDICTED: Homo sapiens olfactory receptor family 2 subfamily AT member 4 (OR2AT4), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OR2AT4 (341152)
Length:
2200
CDS:
1179..2141

Additional Resources:

NCBI RefSeq record:
XM_017017657.1
NBCI Gene record:
OR2AT4 (341152)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017657.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005150 CGTCTTCTATCTATTGGGCAT pLKO.1 1220 CDS 100% 2.160 3.024 N OR2AT4 n/a
2 TRCN0000005154 CCTCAGTGCTTCGCATCAGTT pLKO.1 1861 CDS 100% 4.950 3.465 N OR2AT4 n/a
3 TRCN0000005152 CCTTCTCATCCTGATGGGTAA pLKO.1 1298 CDS 100% 4.050 2.835 N OR2AT4 n/a
4 TRCN0000005151 CCAGATGGCATATAACAGCAT pLKO.1 1685 CDS 100% 2.640 1.848 N OR2AT4 n/a
5 TRCN0000005153 CTCATCTATTGCCATAGCCTA pLKO.1 1949 CDS 100% 2.640 1.848 N OR2AT4 n/a
6 TRCN0000204255 CCACAAGCCCATGTACTTCTT pLKO.1 1358 CDS 100% 4.950 2.970 N Olfr1336 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017657.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.