Transcript: Human XM_017017691.2

PREDICTED: Homo sapiens solute carrier family 22 member 25 (SLC22A25), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC22A25 (387601)
Length:
3025
CDS:
107..1465

Additional Resources:

NCBI RefSeq record:
XM_017017691.2
NBCI Gene record:
SLC22A25 (387601)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017691.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043029 GCTGCTAGTATTGGACATATA pLKO.1 539 CDS 100% 13.200 18.480 N SLC22A25 n/a
2 TRCN0000043031 CTTTGTGAATTGCTCCGCATA pLKO.1 830 CDS 100% 4.050 5.670 N SLC22A25 n/a
3 TRCN0000436025 CAAACCAGAAGAGGGCTTAAA pLKO_005 691 CDS 100% 13.200 10.560 N SLC22A25 n/a
4 TRCN0000043030 GCTGCTACATTTAGCATCATT pLKO.1 443 CDS 100% 0.563 0.394 N SLC22A25 n/a
5 TRCN0000043032 GCACCATGCTTTGTCTTCTTT pLKO.1 620 CDS 100% 5.625 3.375 N SLC22A25 n/a
6 TRCN0000043453 CCTTCCTGAAACCAGGAACAA pLKO.1 1363 CDS 100% 0.495 0.248 Y SLC22A9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017691.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.