Transcript: Human XM_017017841.2

PREDICTED: Homo sapiens NADPH oxidase 4 (NOX4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NOX4 (50507)
Length:
2323
CDS:
188..1906

Additional Resources:

NCBI RefSeq record:
XM_017017841.2
NBCI Gene record:
NOX4 (50507)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017841.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359777 GTAACTCCATTTGCATCAATA pLKO_005 1472 CDS 100% 13.200 10.560 N NOX4 n/a
2 TRCN0000359708 AGTAACCAGAACAACTCATAT pLKO_005 1847 CDS 100% 13.200 9.240 N NOX4 n/a
3 TRCN0000359706 TCTAGTCAAGACTCCGAAATT pLKO_005 1334 CDS 100% 13.200 9.240 N NOX4 n/a
4 TRCN0000046092 GAGCCTCAGCATCTGTTCTTA pLKO.1 423 CDS 100% 5.625 3.938 N NOX4 n/a
5 TRCN0000046088 CCTGTGGTGTTACTATCTGTA pLKO.1 570 CDS 100% 4.950 3.465 N NOX4 n/a
6 TRCN0000046089 GCTGTATATTGATGGTCCTTT pLKO.1 1387 CDS 100% 4.950 3.465 N NOX4 n/a
7 TRCN0000046091 CAGAGTTTACCCAGCACAAAT pLKO.1 945 CDS 100% 13.200 7.920 N NOX4 n/a
8 TRCN0000046111 CCTCAGTCAAACAGATGGGAT pLKO.1 1660 CDS 100% 2.640 1.584 N LOC729960 n/a
9 TRCN0000046090 CCCTCAACTTCTCAGTGAATT pLKO.1 630 CDS 100% 0.000 0.000 N NOX4 n/a
10 TRCN0000359707 TCACCATCATTTCGGTCATAA pLKO_005 1095 CDS 100% 13.200 18.480 N NOX4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017841.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03145 pDONR223 100% 90.2% 89.3% None (many diffs) n/a
2 ccsbBroad304_03145 pLX_304 0% 90.2% 89.3% V5 (many diffs) n/a
Download CSV