Transcript: Human XM_017018141.2

PREDICTED: Homo sapiens transmembrane protein 135 (TMEM135), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM135 (65084)
Length:
3523
CDS:
138..1130

Additional Resources:

NCBI RefSeq record:
XM_017018141.2
NBCI Gene record:
TMEM135 (65084)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018141.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130054 GCTTTCGTGTAGAGCAATTTA pLKO.1 1645 3UTR 100% 15.000 21.000 N TMEM135 n/a
2 TRCN0000276034 GCTTTCGTGTAGAGCAATTTA pLKO_005 1645 3UTR 100% 15.000 21.000 N TMEM135 n/a
3 TRCN0000128517 CCAGTGAACCTATGTACTAAT pLKO.1 1806 3UTR 100% 13.200 18.480 N TMEM135 n/a
4 TRCN0000129812 CCTATGTACTAATGGCAAGTT pLKO.1 1814 3UTR 100% 4.950 6.930 N TMEM135 n/a
5 TRCN0000128444 GCCACTTTATCATTTGGTCAA pLKO.1 2616 3UTR 100% 4.050 5.670 N TMEM135 n/a
6 TRCN0000128547 GCATCTAAACACTTTCAGGAT pLKO.1 1044 CDS 100% 2.640 2.112 N TMEM135 n/a
7 TRCN0000275987 ATGCAGATACTATCATCTATT pLKO_005 880 CDS 100% 13.200 9.240 N TMEM135 n/a
8 TRCN0000174425 CTATTCCATCTCTACAGCAAT pLKO.1 896 CDS 100% 4.950 3.465 N Tmem135 n/a
9 TRCN0000279202 CTATTCCATCTCTACAGCAAT pLKO_005 896 CDS 100% 4.950 3.465 N Tmem135 n/a
10 TRCN0000128877 GAGACCATCTTACTGGAAGTT pLKO.1 953 CDS 100% 4.950 3.465 N TMEM135 n/a
11 TRCN0000130539 GCTTTGTAGAACTGACCTGTT pLKO.1 2655 3UTR 100% 4.050 2.835 N TMEM135 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018141.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.