Transcript: Human XM_017018176.1

PREDICTED: Homo sapiens spectrin beta, non-erythrocytic 2 (SPTBN2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPTBN2 (6712)
Length:
10723
CDS:
176..7348

Additional Resources:

NCBI RefSeq record:
XM_017018176.1
NBCI Gene record:
SPTBN2 (6712)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018176.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423832 TGACTATGCTCCGAGACAAAT pLKO_005 5361 CDS 100% 13.200 18.480 N SPTBN2 n/a
2 TRCN0000117129 GCAGGTTATCCCAACGTCAAT pLKO.1 746 CDS 100% 4.950 6.930 N SPTBN2 n/a
3 TRCN0000431243 ATACTGCCAAAGCCTACAAAG pLKO_005 479 CDS 100% 10.800 7.560 N SPTBN2 n/a
4 TRCN0000117130 CGCGGATCTAGTCATCAAGAA pLKO.1 5998 CDS 100% 4.950 3.465 N SPTBN2 n/a
5 TRCN0000117131 CCTGCATACTAAGTGGCAGAA pLKO.1 4108 CDS 100% 4.050 2.835 N SPTBN2 n/a
6 TRCN0000117128 CGTCGCCTTTGATTACCGAAA pLKO.1 7027 CDS 100% 4.050 2.835 N SPTBN2 n/a
7 TRCN0000117127 GCCCTTCTCTTCTGCTGTTTA pLKO.1 7519 3UTR 100% 13.200 7.920 N SPTBN2 n/a
8 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 9873 3UTR 100% 4.950 2.475 Y ERAP2 n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 9874 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018176.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.