Transcript: Human XM_017018227.2

PREDICTED: Homo sapiens UV radiation resistance associated (UVRAG), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UVRAG (7405)
Length:
4595
CDS:
718..1779

Additional Resources:

NCBI RefSeq record:
XM_017018227.2
NBCI Gene record:
UVRAG (7405)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018227.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000376394 TGCGGTGTCAAGTTGCCTAAT pLKO_005 449 5UTR 100% 10.800 8.640 N UVRAG n/a
2 TRCN0000368916 ACTTAACCCTTTGTGATAATG pLKO_005 1841 3UTR 100% 13.200 9.240 N UVRAG n/a
3 TRCN0000121011 CCTACATTTACCCTATTGATT pLKO.1 402 5UTR 100% 5.625 3.938 N Uvrag n/a
4 TRCN0000005198 CCTTAGTTTCTCATAAGCATT pLKO.1 2138 3UTR 100% 4.950 3.465 N UVRAG n/a
5 TRCN0000005200 GCAGTTTGATTATGGTGTCTA pLKO.1 861 CDS 100% 4.950 3.465 N UVRAG n/a
6 TRCN0000005202 CCTAGCCAAGAACAAGGAGAA pLKO.1 1420 CDS 100% 4.050 2.835 N UVRAG n/a
7 TRCN0000005201 GCCCTTGGTTATACTGCACAT pLKO.1 688 5UTR 100% 4.050 2.835 N UVRAG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018227.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.