Transcript: Human XM_017018541.2

PREDICTED: Homo sapiens solute carrier family 39 member 13 (SLC39A13), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC39A13 (91252)
Length:
2202
CDS:
82..1068

Additional Resources:

NCBI RefSeq record:
XM_017018541.2
NBCI Gene record:
SLC39A13 (91252)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018541.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427708 ATTCACTCTGTGACCGCATAT pLKO_005 1118 3UTR 100% 10.800 15.120 N SLC39A13 n/a
2 TRCN0000443941 GCTGGCCAACACCATCGATAA pLKO_005 639 CDS 100% 10.800 15.120 N SLC39A13 n/a
3 TRCN0000042847 CGGCTTTCTCTACATCGCCTT pLKO.1 930 CDS 100% 2.160 1.728 N SLC39A13 n/a
4 TRCN0000433730 GACTCTTGGGCAATGTGTTTC pLKO_005 428 CDS 100% 10.800 7.560 N SLC39A13 n/a
5 TRCN0000042844 CCTGGCGTTGGAGAAGATGTT pLKO.1 567 CDS 100% 4.950 3.465 N SLC39A13 n/a
6 TRCN0000439070 GAGGTGCGTGTGGATGTATGT pLKO_005 1199 3UTR 100% 4.950 3.465 N SLC39A13 n/a
7 TRCN0000438619 GCCAAGCTGCAACTCTCAACA pLKO_005 811 CDS 100% 4.950 3.465 N SLC39A13 n/a
8 TRCN0000042846 CATCGTGGTAATGGTGCTGTT pLKO.1 1029 CDS 100% 4.050 2.835 N SLC39A13 n/a
9 TRCN0000042845 CTTCCTTGTGAGCAAGAAGAT pLKO.1 690 CDS 100% 4.950 2.970 N SLC39A13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018541.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16061 pDONR223 0% 90% 89.8% None 83A>G;537_538ins108 n/a
2 ccsbBroad304_16061 pLX_304 0% 90% 89.8% V5 83A>G;537_538ins108 n/a
Download CSV