Transcript: Human XM_017018739.1

PREDICTED: Homo sapiens citron rho-interacting serine/threonine kinase (CIT), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CIT (11113)
Length:
8795
CDS:
1717..6354

Additional Resources:

NCBI RefSeq record:
XM_017018739.1
NBCI Gene record:
CIT (11113)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018739.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006315 GCGTCCTCATACCAGGATAAA pLKO.1 5929 CDS 100% 13.200 18.480 N CIT n/a
2 TRCN0000277814 GCGTCCTCATACCAGGATAAA pLKO_005 5929 CDS 100% 13.200 18.480 N CIT n/a
3 TRCN0000195505 CCATTTCCTCAGGAGCGATTT pLKO.1 5903 CDS 100% 10.800 7.560 N CIT n/a
4 TRCN0000006314 GCCAATAAACTTGCAGCAAAT pLKO.1 2677 CDS 100% 10.800 7.560 N CIT n/a
5 TRCN0000277745 GCCAATAAACTTGCAGCAAAT pLKO_005 2677 CDS 100% 10.800 7.560 N CIT n/a
6 TRCN0000006313 CCCTCCTATTAGAGTACGAAA pLKO.1 7776 3UTR 100% 4.950 3.465 N CIT n/a
7 TRCN0000277747 CCCTCCTATTAGAGTACGAAA pLKO_005 7776 3UTR 100% 4.950 3.465 N CIT n/a
8 TRCN0000197232 GCATCCAAATGTCTCGAATGT pLKO.1 4438 CDS 100% 4.950 3.465 N CIT n/a
9 TRCN0000006317 GCTGATCTACTGAAGACAGAA pLKO.1 3868 CDS 100% 4.950 3.465 N CIT n/a
10 TRCN0000277748 GCTGATCTACTGAAGACAGAA pLKO_005 3868 CDS 100% 4.950 3.465 N CIT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018739.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.