Transcript: Human XM_017019089.1

PREDICTED: Homo sapiens tensin 2 (TNS2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TNS2 (23371)
Length:
4756
CDS:
28..4266

Additional Resources:

NCBI RefSeq record:
XM_017019089.1
NBCI Gene record:
TNS2 (23371)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019089.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272884 ACAGCACGTGGTCGTACTATA pLKO_005 678 CDS 100% 13.200 18.480 N TNS2 n/a
2 TRCN0000272948 GCATGACCTGACCCGCTTAAA pLKO_005 555 CDS 100% 13.200 18.480 N TNS2 n/a
3 TRCN0000001976 CCACTCTTACCATGCGGAAAT pLKO.1 788 CDS 100% 10.800 15.120 N TNS2 n/a
4 TRCN0000001975 ACTGACGGACAACCAAAGGAA pLKO.1 4008 CDS 100% 3.000 4.200 N TNS2 n/a
5 TRCN0000025680 GTCACCTTCATCACCAAAGTT pLKO.1 4225 CDS 100% 5.625 3.938 N Tns2 n/a
6 TRCN0000001977 AGAGAGCCAAAGCAATGTCAA pLKO.1 3408 CDS 100% 4.950 3.465 N TNS2 n/a
7 TRCN0000272885 AGAGAGCCAAAGCAATGTCAA pLKO_005 3408 CDS 100% 4.950 3.465 N TNS2 n/a
8 TRCN0000272886 TCAGAGCCCACATCAACACTG pLKO_005 4282 3UTR 100% 4.050 2.835 N TNS2 n/a
9 TRCN0000001979 AGCAGAGATTCAGAGTAGGAT pLKO.1 4671 3UTR 100% 3.000 2.100 N TNS2 n/a
10 TRCN0000001978 CCACCAAATCTCTGAACCACT pLKO.1 314 CDS 100% 2.640 1.848 N TNS2 n/a
11 TRCN0000272947 CCACCAAATCTCTGAACCACT pLKO_005 314 CDS 100% 2.640 1.848 N TNS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019089.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.