Transcript: Human XM_017019090.1

PREDICTED: Homo sapiens mediator complex subunit 13L (MED13L), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MED13L (23389)
Length:
9408
CDS:
89..6718

Additional Resources:

NCBI RefSeq record:
XM_017019090.1
NBCI Gene record:
MED13L (23389)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019090.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233504 CACCGTGATGTTGCCTATATT pLKO_005 4328 CDS 100% 15.000 21.000 N MED13L n/a
2 TRCN0000005082 GCCTATTGATACCACCTAAAT pLKO.1 4650 CDS 100% 13.200 18.480 N MED13L n/a
3 TRCN0000005085 GCGATTATGAACCGCAAACTT pLKO.1 3581 CDS 100% 5.625 7.875 N MED13L n/a
4 TRCN0000005083 CCCGAGGAAATTAAGGACTTT pLKO.1 2861 CDS 100% 4.950 3.960 N MED13L n/a
5 TRCN0000233506 ATATAGTCACAACGGAAATAT pLKO_005 7659 3UTR 100% 15.000 10.500 N MED13L n/a
6 TRCN0000233505 CATCACCTAGCACCTTATTTA pLKO_005 4607 CDS 100% 15.000 10.500 N MED13L n/a
7 TRCN0000005084 CCCAACCTAGTGGGTGTAATA pLKO.1 362 CDS 100% 13.200 9.240 N MED13L n/a
8 TRCN0000233503 TGATCAATGAGGAGCATATAC pLKO_005 660 CDS 100% 13.200 9.240 N MED13L n/a
9 TRCN0000005081 CCTGTTTCTAACCCTTGTGTT pLKO.1 7978 3UTR 100% 4.950 3.465 N MED13L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019090.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.