Transcript: Human XM_017019177.1

PREDICTED: Homo sapiens F-box and WD repeat domain containing 8 (FBXW8), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FBXW8 (26259)
Length:
1460
CDS:
89..1360

Additional Resources:

NCBI RefSeq record:
XM_017019177.1
NBCI Gene record:
FBXW8 (26259)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019177.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004323 GTGTGGTCATTGCGGGATATA pLKO.1 753 CDS 100% 13.200 18.480 N FBXW8 n/a
2 TRCN0000416918 TGGCAGATAGCTGCGGAATTT pLKO_005 1088 CDS 100% 13.200 18.480 N FBXW8 n/a
3 TRCN0000419042 GCAAGACGTGGAAGGTGATTG pLKO_005 519 CDS 100% 10.800 15.120 N FBXW8 n/a
4 TRCN0000418540 TACGAATTGGCAATCAATATA pLKO_005 452 CDS 100% 15.000 12.000 N FBXW8 n/a
5 TRCN0000421442 GTCTCCTTTGTGAGGATAAAC pLKO_005 875 CDS 100% 13.200 9.240 N FBXW8 n/a
6 TRCN0000423254 TTTGAGCACGATGCAAGAATA pLKO_005 977 CDS 100% 13.200 9.240 N FBXW8 n/a
7 TRCN0000413898 GAGCCAAGGAACACATGTTAC pLKO_005 645 CDS 100% 10.800 7.560 N FBXW8 n/a
8 TRCN0000004322 GCAGCTTATGAGGATGGGTTT pLKO.1 911 CDS 100% 4.050 2.835 N FBXW8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019177.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.