Transcript: Human XM_017019298.1

PREDICTED: Homo sapiens fidgetin like 2 (FIGNL2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FIGNL2 (401720)
Length:
4936
CDS:
73..2376

Additional Resources:

NCBI RefSeq record:
XM_017019298.1
NBCI Gene record:
FIGNL2 (401720)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019298.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156271 CCGTGCATTTCCTAGAGTCTA pLKO.1 4153 3UTR 100% 4.950 6.930 N FIGNL2 n/a
2 TRCN0000154719 GAACCCTTCCAAGAACCATAT pLKO.1 3967 3UTR 100% 10.800 7.560 N FIGNL2 n/a
3 TRCN0000158091 CCATCCCATTCTCTGCATTCT pLKO.1 2749 3UTR 100% 4.950 3.465 N FIGNL2 n/a
4 TRCN0000154360 CTAAGCAGAAAGTCTCCAGAA pLKO.1 3639 3UTR 100% 4.050 2.835 N FIGNL2 n/a
5 TRCN0000158148 CCTCTACCCATCTGAAACCTA pLKO.1 3026 3UTR 100% 3.000 2.100 N FIGNL2 n/a
6 TRCN0000156372 CCTGAACTTTCCACTAGGCTT pLKO.1 3945 3UTR 100% 2.640 1.584 N FIGNL2 n/a
7 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 26 5UTR 100% 1.080 0.540 Y GPR83 n/a
8 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 26 5UTR 100% 1.080 0.540 Y MYORG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019298.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.