Transcript: Human XM_017019827.1

PREDICTED: Homo sapiens TBC1 domain family member 15 (TBC1D15), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TBC1D15 (64786)
Length:
2900
CDS:
148..1791

Additional Resources:

NCBI RefSeq record:
XM_017019827.1
NBCI Gene record:
TBC1D15 (64786)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019827.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231963 GCATTAGATTCCTCTAGTATT pLKO_005 23 5UTR 100% 13.200 18.480 N TBC1D15 n/a
2 TRCN0000151278 CGATTGTTAGACAGTGGATTT pLKO.1 1234 CDS 100% 10.800 15.120 N TBC1D15 n/a
3 TRCN0000216709 CTTCGATTATGGGAGGTAATG pLKO.1 1351 CDS 100% 10.800 15.120 N Tbc1d15 n/a
4 TRCN0000155436 CCAGATTCAGACGTTGGTGAA pLKO.1 1627 CDS 100% 4.050 5.670 N TBC1D15 n/a
5 TRCN0000154685 GAGGTAATGTGGACCGAACTA pLKO.1 1363 CDS 100% 4.950 3.960 N TBC1D15 n/a
6 TRCN0000155572 CCTGTTCAGTTTGACAGACCT pLKO.1 99 5UTR 100% 2.640 2.112 N TBC1D15 n/a
7 TRCN0000231966 TAAGTGGATTGGCAGTATATT pLKO_005 2353 3UTR 100% 15.000 10.500 N TBC1D15 n/a
8 TRCN0000152199 CCGAACTACCATGTACAAATT pLKO.1 1376 CDS 100% 13.200 9.240 N TBC1D15 n/a
9 TRCN0000231964 GGGTATGGGCTGGTCCTATTT pLKO_005 144 5UTR 100% 13.200 9.240 N TBC1D15 n/a
10 TRCN0000231965 TCTAGATATTCTTCGATTATG pLKO_005 1341 CDS 100% 13.200 9.240 N TBC1D15 n/a
11 TRCN0000155787 CAGATACCAGTGTCCTCAGAT pLKO.1 1747 CDS 100% 4.950 3.465 N TBC1D15 n/a
12 TRCN0000152174 CCAAGTCATAGAAATGGGAAA pLKO.1 64 5UTR 100% 4.050 2.835 N TBC1D15 n/a
13 TRCN0000150682 GAGATTATGTTCAACCCTGTA pLKO.1 2566 3UTR 100% 4.050 2.835 N TBC1D15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019827.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12494 pDONR223 100% 79.1% 79% None 0_1ins432;1189A>G n/a
2 ccsbBroad304_12494 pLX_304 0% 79.1% 79% V5 0_1ins432;1189A>G n/a
Download CSV