Transcript: Human XM_017020006.1

PREDICTED: Homo sapiens transmembrane O-mannosyltransferase targeting cadherins 1 (TMTC1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMTC1 (83857)
Length:
8994
CDS:
130..2136

Additional Resources:

NCBI RefSeq record:
XM_017020006.1
NBCI Gene record:
TMTC1 (83857)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020006.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148792 CGCCTTACATTCTTACGAGAT pLKO.1 1235 CDS 100% 4.050 5.670 N TMTC1 n/a
2 TRCN0000149357 GCAGGATAATCCAGCTTCATT pLKO.1 1212 CDS 100% 5.625 3.938 N TMTC1 n/a
3 TRCN0000149558 GCCAAGGTTCACTACAACTAT pLKO.1 1762 CDS 100% 5.625 3.938 N TMTC1 n/a
4 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 5195 3UTR 100% 4.950 2.475 Y ORAI2 n/a
5 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 8736 3UTR 100% 13.200 6.600 Y LIAS n/a
6 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 5192 3UTR 100% 4.950 2.475 Y LOC339059 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 7997 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020006.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09120 pDONR223 100% 52.2% 51.9% None (many diffs) n/a
2 ccsbBroad304_09120 pLX_304 0% 52.2% 51.9% V5 (many diffs) n/a
Download CSV