Transcript: Human XM_017020080.1

PREDICTED: Homo sapiens PTPRF interacting protein alpha 2 (PPFIA2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPFIA2 (8499)
Length:
4897
CDS:
293..4066

Additional Resources:

NCBI RefSeq record:
XM_017020080.1
NBCI Gene record:
PPFIA2 (8499)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020080.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000355830 GTGGAGCAATGACCGAGTTAT pLKO_005 3613 CDS 100% 13.200 18.480 N PPFIA2 n/a
2 TRCN0000355897 ACGACATGAAAGATCACTAAG pLKO_005 730 CDS 100% 10.800 15.120 N PPFIA2 n/a
3 TRCN0000002965 CTAAGAAGACGAGCAGTGAAA pLKO.1 4142 3UTR 100% 4.950 6.930 N PPFIA2 n/a
4 TRCN0000002963 CCTACCACAATGATGCTCGAA pLKO.1 2664 CDS 100% 2.640 3.696 N PPFIA2 n/a
5 TRCN0000355898 AGCAATTGGACTTCGAGAATA pLKO_005 3646 CDS 100% 13.200 9.240 N PPFIA2 n/a
6 TRCN0000355828 CAATCCACTGCATCGCTTAAA pLKO_005 3130 CDS 100% 13.200 9.240 N PPFIA2 n/a
7 TRCN0000002966 CAAGACTATTACTGGAGCATT pLKO.1 693 CDS 100% 4.950 3.465 N PPFIA2 n/a
8 TRCN0000002964 CCTCCATTACTGCCTCTGTTA pLKO.1 2397 CDS 100% 4.950 3.465 N PPFIA2 n/a
9 TRCN0000002962 GCTGAGAAGGATCGAAGACTA pLKO.1 2906 CDS 100% 4.950 3.465 N PPFIA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020080.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.