Transcript: Human XM_017020168.1

PREDICTED: Homo sapiens neuron navigator 3 (NAV3), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NAV3 (89795)
Length:
13337
CDS:
4176..10844

Additional Resources:

NCBI RefSeq record:
XM_017020168.1
NBCI Gene record:
NAV3 (89795)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020168.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107068 CCAGTCCTTATCTAAGCCTAT pLKO.1 5861 CDS 100% 4.050 5.670 N NAV3 n/a
2 TRCN0000310383 CCAGTCCTTATCTAAGCCTAT pLKO_005 5861 CDS 100% 4.050 5.670 N NAV3 n/a
3 TRCN0000218037 CAATTACCCAAAGGTACTTTA pLKO_005 9796 CDS 100% 13.200 10.560 N Nav3 n/a
4 TRCN0000303440 CAATTACCCAAAGGTACTTTA pLKO_005 9796 CDS 100% 13.200 10.560 N NAV3 n/a
5 TRCN0000107067 CGTCTCTTTAAGGAATATGTA pLKO.1 9561 CDS 100% 5.625 4.500 N NAV3 n/a
6 TRCN0000107066 GCACTGTTCTTCAAGACCTTT pLKO.1 4280 CDS 100% 4.950 3.960 N NAV3 n/a
7 TRCN0000107069 GCAGAAATCATCCAGATTATT pLKO.1 4515 CDS 100% 15.000 10.500 N NAV3 n/a
8 TRCN0000299127 GCAGAAATCATCCAGATTATT pLKO_005 4515 CDS 100% 15.000 10.500 N NAV3 n/a
9 TRCN0000303441 GGTCGATGTGGGTGGATATAT pLKO_005 6617 CDS 100% 15.000 10.500 N NAV3 n/a
10 TRCN0000107065 GCCTTGTGAATAGATCGCTTT pLKO.1 11847 3UTR 100% 4.050 2.835 N NAV3 n/a
11 TRCN0000299126 GCCTTGTGAATAGATCGCTTT pLKO_005 11847 3UTR 100% 4.050 2.835 N NAV3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020168.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.