Transcript: Human XM_017020382.1

PREDICTED: Homo sapiens A-kinase anchoring protein 11 (AKAP11), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AKAP11 (11215)
Length:
9760
CDS:
152..5722

Additional Resources:

NCBI RefSeq record:
XM_017020382.1
NBCI Gene record:
AKAP11 (11215)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020382.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000279897 GTGTTATCACTCGGTGTATAT pLKO_005 5866 3UTR 100% 13.200 10.560 N AKAP11 n/a
2 TRCN0000380096 AGGTTCCAGTGATAGAGTTAT pLKO_005 6079 3UTR 100% 13.200 9.240 N AKAP11 n/a
3 TRCN0000001917 CCTGTGATGAAAGATGATATA pLKO.1 1031 CDS 100% 13.200 9.240 N AKAP11 n/a
4 TRCN0000297744 CCTGTGATGAAAGATGATATA pLKO_005 1031 CDS 100% 13.200 9.240 N AKAP11 n/a
5 TRCN0000001918 GTGGTAATAGTGAGTTGATAA pLKO.1 4086 CDS 100% 13.200 9.240 N AKAP11 n/a
6 TRCN0000279967 GTGGTAATAGTGAGTTGATAA pLKO_005 4086 CDS 100% 13.200 9.240 N AKAP11 n/a
7 TRCN0000001919 GTTGGTAGTTTGTCTGAGAAT pLKO.1 3452 CDS 100% 4.950 3.465 N AKAP11 n/a
8 TRCN0000297340 GTTGGTAGTTTGTCTGAGAAT pLKO_005 3452 CDS 100% 4.950 3.465 N AKAP11 n/a
9 TRCN0000001920 GCCTATAAAGATTGTGCAGTA pLKO.1 6547 3UTR 100% 4.050 2.835 N AKAP11 n/a
10 TRCN0000001916 GCTGAGAAGATAGTTGCTGAA pLKO.1 4967 CDS 100% 4.050 2.835 N AKAP11 n/a
11 TRCN0000279896 GCTGAGAAGATAGTTGCTGAA pLKO_005 4967 CDS 100% 4.050 2.835 N AKAP11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020382.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.