Transcript: Human XM_017020877.1

PREDICTED: Homo sapiens mitochondrial translation release factor 1 (MTRF1), transcript variant X35, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MTRF1 (9617)
Length:
2456
CDS:
966..1811

Additional Resources:

NCBI RefSeq record:
XM_017020877.1
NBCI Gene record:
MTRF1 (9617)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020877.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232959 GATTTGCGAATAGATACATTT pLKO_005 1368 CDS 100% 13.200 18.480 N MTRF1 n/a
2 TRCN0000154320 CCAGCAGATTATGGTGGACTA pLKO.1 1158 CDS 100% 4.050 5.670 N MTRF1 n/a
3 TRCN0000155034 GCTAGACTCTACCAGCAGATT pLKO.1 1533 CDS 100% 4.950 3.960 N MTRF1 n/a
4 TRCN0000232958 CAGAATTATTCGTGCTATAAA pLKO_005 1107 CDS 100% 15.000 10.500 N MTRF1 n/a
5 TRCN0000232957 CCAACAATTTACCCGAGAAAT pLKO_005 1073 CDS 100% 13.200 9.240 N MTRF1 n/a
6 TRCN0000232960 TAAATGAAATGGACCTATATC pLKO_005 1841 3UTR 100% 13.200 9.240 N MTRF1 n/a
7 TRCN0000152306 CCAACAAGAAAGATCACAGAT pLKO.1 1478 CDS 100% 4.950 3.465 N MTRF1 n/a
8 TRCN0000150642 GACAAGTCACTTGTTCTCTTT pLKO.1 2083 3UTR 100% 4.950 3.465 N MTRF1 n/a
9 TRCN0000154737 GCATTCACACAGGAACGATGT pLKO.1 1294 CDS 100% 4.050 2.835 N MTRF1 n/a
10 TRCN0000155064 GCCTGGATCAGCTAATTCAGA pLKO.1 1720 CDS 100% 3.000 2.100 N MTRF1 n/a
11 TRCN0000153013 GAAGTCACATTTCCTGACCTA pLKO.1 1956 3UTR 100% 2.640 1.848 N MTRF1 n/a
12 TRCN0000257053 TTTCCGGTGACGGTGTCTATA pLKO_005 1198 CDS 100% 13.200 7.920 N MTRF1 n/a
13 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 870 5UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020877.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.