Transcript: Human XM_017020924.1

PREDICTED: Homo sapiens gephyrin (GPHN), transcript variant X20, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GPHN (10243)
Length:
3933
CDS:
1606..3066

Additional Resources:

NCBI RefSeq record:
XM_017020924.1
NBCI Gene record:
GPHN (10243)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020924.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364523 CCCATCGGCCATGACATTAAA pLKO_005 2230 CDS 100% 15.000 21.000 N GPHN n/a
2 TRCN0000119043 CCCACGATCAACTTGGGTATT pLKO.1 2473 CDS 100% 10.800 15.120 N GPHN n/a
3 TRCN0000119045 GAGTCCTTACAGTGAGTGATA pLKO.1 647 5UTR 100% 4.950 6.930 N GPHN n/a
4 TRCN0000098587 GCATACAAGATAGTACCAGAT pLKO.1 757 5UTR 100% 4.050 5.670 N Gphn n/a
5 TRCN0000119044 GCCAATGGATTGTTGATGCTA pLKO.1 2971 CDS 100% 3.000 4.200 N GPHN n/a
6 TRCN0000119046 CCAGAATACCATCGGTGTATA pLKO.1 2866 CDS 100% 13.200 10.560 N GPHN n/a
7 TRCN0000369145 CAGTCACAGTGCTGTCGATAT pLKO_005 1761 CDS 100% 10.800 8.640 N GPHN n/a
8 TRCN0000364524 ATAGTTCCTCATCACATATAA pLKO_005 1319 5UTR 100% 15.000 10.500 N GPHN n/a
9 TRCN0000313416 GAAGACCGCAGTGGGATAAAT pLKO_005 688 5UTR 100% 15.000 10.500 N Gphn n/a
10 TRCN0000364532 GAAGACCGCAGTGGGATAAAT pLKO_005 688 5UTR 100% 15.000 10.500 N GPHN n/a
11 TRCN0000369147 GTCAACATCTTGAACTATATT pLKO_005 3179 3UTR 100% 15.000 10.500 N GPHN n/a
12 TRCN0000364516 AGTGGAAGATACCGAACTTAT pLKO_005 2133 CDS 100% 13.200 9.240 N GPHN n/a
13 TRCN0000119042 CCTTCTTAGTATGCTTCATAA pLKO.1 3469 3UTR 100% 13.200 9.240 N GPHN n/a
14 TRCN0000364460 TCTCATGTATCTCGTGTTTAT pLKO_005 3520 3UTR 100% 13.200 9.240 N GPHN n/a
15 TRCN0000369146 CATCATCAAAGCAAGGTTATC pLKO_005 2820 CDS 100% 10.800 7.560 N GPHN n/a
16 TRCN0000098585 CCCTTCTTAGTATGCTTCATA pLKO.1 3468 3UTR 100% 5.625 3.938 N Gphn n/a
17 TRCN0000312312 CCCTTCTTAGTATGCTTCATA pLKO_005 3468 3UTR 100% 5.625 3.938 N Gphn n/a
18 TRCN0000098589 GCAAGAAAGGATCTCAGGAAT pLKO.1 1073 5UTR 100% 4.950 3.465 N Gphn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020924.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.