Transcript: Human XM_017020928.2

PREDICTED: Homo sapiens Sec23 homolog A, coat complex II component (SEC23A), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SEC23A (10484)
Length:
2576
CDS:
226..2472

Additional Resources:

NCBI RefSeq record:
XM_017020928.2
NBCI Gene record:
SEC23A (10484)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020928.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232509 ACGAGATGGAGTCCGATTTAG pLKO_005 264 CDS 100% 13.200 18.480 N SEC23A n/a
2 TRCN0000232512 ACTACAACCTTAGCCATATAT pLKO_005 1585 CDS 100% 15.000 10.500 N SEC23A n/a
3 TRCN0000065262 CCCTTCACAGACTCATAATAA pLKO.1 2394 CDS 100% 15.000 10.500 N SEC23A n/a
4 TRCN0000232510 ACCTAGTTATGCTGGTATATC pLKO_005 510 CDS 100% 13.200 9.240 N SEC23A n/a
5 TRCN0000232511 ATGAGTTGAAGACACCTATAA pLKO_005 1136 CDS 100% 13.200 9.240 N SEC23A n/a
6 TRCN0000065260 GCTGGTATATCTGAACTGAAT pLKO.1 520 CDS 100% 4.950 3.465 N SEC23A n/a
7 TRCN0000100894 CCTACAGCTTTGGTTGGACTT pLKO.1 703 CDS 100% 4.050 2.835 N Sec23a n/a
8 TRCN0000065258 CGCTAGAAATAAAGACCTCAA pLKO.1 1439 CDS 100% 4.050 2.835 N SEC23A n/a
9 TRCN0000065261 CCTCCTTCCAACAGATTCTTA pLKO.1 895 CDS 100% 5.625 3.375 N SEC23A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020928.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.