Transcript: Human XM_017021110.2

PREDICTED: Homo sapiens phosphofurin acidic cluster sorting protein 2 (PACS2), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PACS2 (23241)
Length:
6207
CDS:
60..2732

Additional Resources:

NCBI RefSeq record:
XM_017021110.2
NBCI Gene record:
PACS2 (23241)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021110.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000168619 GCAACAGAACTTCAAGCAGAA pLKO.1 800 CDS 100% 4.050 5.670 N PACS2 n/a
2 TRCN0000136046 GATTGTAAGAACGACGTCCAT pLKO.1 773 CDS 100% 2.640 3.696 N PACS2 n/a
3 TRCN0000134533 GAAGAACAAGAAGGTGATGTT pLKO.1 2486 CDS 100% 4.950 3.465 N PACS2 n/a
4 TRCN0000137443 GACCAGGCAACAGAACTTCAA pLKO.1 794 CDS 100% 4.950 3.465 N PACS2 n/a
5 TRCN0000135103 CACCAAGGAGAAGAACAAGAA pLKO.1 2477 CDS 100% 4.950 2.475 Y PACS2 n/a
6 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 4783 3UTR 100% 4.950 2.475 Y LOC387873 n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4820 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000157610 GTGGCATGATCTCAGCTCATT pLKO.1 4617 3UTR 100% 4.950 2.475 Y CCNJL n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4820 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021110.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.