Transcript: Human XM_017021152.2

PREDICTED: Homo sapiens HECT domain E3 ubiquitin protein ligase 1 (HECTD1), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HECTD1 (25831)
Length:
8332
CDS:
530..7519

Additional Resources:

NCBI RefSeq record:
XM_017021152.2
NBCI Gene record:
HECTD1 (25831)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021152.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004086 CGAGATTTATACGATGACCAT pLKO.1 3041 CDS 100% 2.640 3.696 N HECTD1 n/a
2 TRCN0000433882 ATGTAGGTCAGACTCTATTAA pLKO_005 1710 CDS 100% 15.000 10.500 N HECTD1 n/a
3 TRCN0000413888 GCATAGAGGATTTAGGTTTAA pLKO_005 6897 CDS 100% 13.200 9.240 N HECTD1 n/a
4 TRCN0000418811 GCTATCAAGAGGCGCCAAATT pLKO_005 6785 CDS 100% 13.200 9.240 N HECTD1 n/a
5 TRCN0000413107 TCGACCAGCAGTTGCGTTAAT pLKO_005 3403 CDS 100% 13.200 9.240 N HECTD1 n/a
6 TRCN0000004087 TCTCTCTTTGTTTGGCATATA pLKO.1 8031 3UTR 100% 13.200 9.240 N HECTD1 n/a
7 TRCN0000004083 GCACTTTCTTACCAGCCCTTT pLKO.1 681 CDS 100% 4.050 2.430 N HECTD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021152.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.