Transcript: Human XM_017021514.1

PREDICTED: Homo sapiens unc-79 homolog, NALCN channel complex subunit (UNC79), transcript variant X15, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UNC79 (57578)
Length:
11098
CDS:
2407..10398

Additional Resources:

NCBI RefSeq record:
XM_017021514.1
NBCI Gene record:
UNC79 (57578)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021514.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000268987 GTCCTCAACTCCGGCATTATT pLKO_005 6722 CDS 100% 15.000 21.000 N Unc79 n/a
2 TRCN0000183021 CCGGTAACATTGAGACTAATA pLKO.1 5389 CDS 100% 13.200 18.480 N UNC79 n/a
3 TRCN0000282561 CGACGGTGATGACGGACAAAT pLKO_005 8492 CDS 100% 13.200 18.480 N UNC79 n/a
4 TRCN0000263299 GGTTTAGCAATAATGGGTTTA pLKO_005 10431 3UTR 100% 10.800 15.120 N UNC79 n/a
5 TRCN0000263298 TCCACTACTGGCCCAATTTAA pLKO_005 3374 CDS 100% 15.000 10.500 N UNC79 n/a
6 TRCN0000263297 TCCGACCCAAGCTGCGTATAT pLKO_005 7200 CDS 100% 13.200 9.240 N UNC79 n/a
7 TRCN0000263300 TGATAACAAGGACGATGATAA pLKO_005 4002 CDS 100% 13.200 9.240 N UNC79 n/a
8 TRCN0000183124 CCAGCTACATTTGGATTGTAA pLKO.1 6072 CDS 100% 5.625 3.938 N UNC79 n/a
9 TRCN0000183484 GAAGCTTTCTTGCTACACATA pLKO.1 10555 3UTR 100% 4.950 3.465 N UNC79 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021514.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.