Transcript: Human XM_017021587.1

PREDICTED: Homo sapiens neuronal PAS domain protein 3 (NPAS3), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NPAS3 (64067)
Length:
8087
CDS:
2525..5020

Additional Resources:

NCBI RefSeq record:
XM_017021587.1
NBCI Gene record:
NPAS3 (64067)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021587.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020976 CCATCATTCGACTTACAATTA pLKO.1 2493 5UTR 100% 13.200 18.480 N NPAS3 n/a
2 TRCN0000369372 TCCACCTAACACATCAGTAAA pLKO_005 2581 CDS 100% 13.200 10.560 N NPAS3 n/a
3 TRCN0000020974 CGAGTAAATATGGACCTCAAT pLKO.1 3224 CDS 100% 4.950 3.960 N NPAS3 n/a
4 TRCN0000364578 CAGTGCCACCATAGCTATTAA pLKO_005 3448 CDS 100% 15.000 10.500 N NPAS3 n/a
5 TRCN0000377339 TAAAGACACCTCAGGTATTAC pLKO_005 3622 CDS 100% 13.200 9.240 N NPAS3 n/a
6 TRCN0000364652 TGACTTATTCTTTCGTGTAAA pLKO_005 5174 3UTR 100% 13.200 9.240 N NPAS3 n/a
7 TRCN0000364580 TGCAGAAGAACGGAGGATATA pLKO_005 3414 CDS 100% 13.200 9.240 N NPAS3 n/a
8 TRCN0000369373 TGGAAAGAGACAAGCATAAAC pLKO_005 5417 3UTR 100% 13.200 9.240 N NPAS3 n/a
9 TRCN0000364654 TCGACAAGGCATCCATCATTC pLKO_005 2481 5UTR 100% 10.800 7.560 N NPAS3 n/a
10 TRCN0000020978 GAACCCATCAATTTCGACAAT pLKO.1 4178 CDS 100% 4.950 3.465 N NPAS3 n/a
11 TRCN0000020975 GCACATCAAATCATCAGGATA pLKO.1 3046 CDS 100% 4.950 3.465 N NPAS3 n/a
12 TRCN0000020977 GCTGTTAACTTCGTGGACGTT pLKO.1 4766 CDS 100% 2.640 1.848 N NPAS3 n/a
13 TRCN0000364651 GCACTAGCCATTGAAGTATTT pLKO_005 2636 CDS 100% 13.200 7.920 N NPAS3 n/a
14 TRCN0000096457 CTCAGGTATTACAGAGGACAA pLKO.1 3631 CDS 100% 4.050 2.430 N Npas3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021587.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.