Transcript: Human XM_017021919.2

PREDICTED: Homo sapiens ATP/GTP binding protein like 1 (AGBL1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AGBL1 (123624)
Length:
12478
CDS:
335..3616

Additional Resources:

NCBI RefSeq record:
XM_017021919.2
NBCI Gene record:
AGBL1 (123624)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021919.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416742 TACGGTTCTTCTCCAAATTTG pLKO_005 2031 CDS 100% 13.200 18.480 N AGBL1 n/a
2 TRCN0000423205 CAGTTCCGACATCGTCCATAT pLKO_005 2618 CDS 100% 10.800 15.120 N AGBL1 n/a
3 TRCN0000181041 CAAGTGCGTGAGTTCGAGTAT pLKO.1 2078 CDS 100% 4.950 6.930 N AGBL1 n/a
4 TRCN0000180893 GCGTGAGTTCGAGTATGACTT pLKO.1 2083 CDS 100% 4.950 6.930 N AGBL1 n/a
5 TRCN0000419358 CATCTGGGAAGTGCTACTATA pLKO_005 2364 CDS 100% 13.200 9.240 N AGBL1 n/a
6 TRCN0000147649 GAAGAGGAACTGATGCAATAT pLKO.1 1364 CDS 100% 13.200 9.240 N AGBL1 n/a
7 TRCN0000180421 GCCCACCCTATATTCTGTGAA pLKO.1 2245 CDS 100% 4.950 3.465 N AGBL1 n/a
8 TRCN0000162166 CAACATGATGAAACCCTGTAT pLKO.1 4636 3UTR 100% 4.950 2.475 Y SWSAP1 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 9524 3UTR 100% 4.950 2.475 Y KAAG1 n/a
10 TRCN0000178741 CACACACATACACACACACAA pLKO.1 9514 3UTR 100% 4.950 2.475 Y Cstad n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021919.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.