Transcript: Human XM_017021976.1

PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif 17 (ADAMTS17), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADAMTS17 (170691)
Length:
6268
CDS:
465..3305

Additional Resources:

NCBI RefSeq record:
XM_017021976.1
NBCI Gene record:
ADAMTS17 (170691)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021976.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431192 AGCGCGATACCTCGGCAATAA pLKO_005 686 CDS 100% 13.200 18.480 N ADAMTS17 n/a
2 TRCN0000418970 CATTAGTGCTTCCGTACTTAA pLKO_005 3450 3UTR 100% 13.200 18.480 N ADAMTS17 n/a
3 TRCN0000010925 GCTAAGAGGAAGTGTGTGCTT pLKO.1 972 CDS 100% 2.640 3.696 N ADAMTS17 n/a
4 TRCN0000005140 GTGTTGTTATTTCACGACCAA pLKO.1 2313 CDS 100% 2.640 3.696 N ADAMTS17 n/a
5 TRCN0000005137 CAGTCCCAAGGGTCGCTCAAA pLKO.1 3310 3UTR 100% 1.650 1.320 N ADAMTS17 n/a
6 TRCN0000005138 GCACCAACTCACAAGGGAAAT pLKO.1 2860 CDS 100% 10.800 7.560 N ADAMTS17 n/a
7 TRCN0000005139 GCAGAAACATGGAGCATCTAA pLKO.1 1327 CDS 100% 5.625 3.938 N ADAMTS17 n/a
8 TRCN0000420437 ACATCTGATCAGGCGCAAATG pLKO_005 266 5UTR 100% 10.800 6.480 N ADAMTS17 n/a
9 TRCN0000162795 CTTCCAAAGTGCTGGGATTAT pLKO.1 5693 3UTR 100% 13.200 6.600 Y SLC48A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021976.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.