Transcript: Human XM_017022035.1

PREDICTED: Homo sapiens synemin (SYNM), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SYNM (23336)
Length:
3734
CDS:
132..3734

Additional Resources:

NCBI RefSeq record:
XM_017022035.1
NBCI Gene record:
SYNM (23336)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022035.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005120 GCGATGTCACATTCTCAGTTA pLKO.1 2509 CDS 100% 4.950 3.465 N SYNM n/a
2 TRCN0000005122 GCCGTCAGAATTCAGAAACAA pLKO.1 1130 CDS 100% 0.000 0.000 N SYNM n/a
3 TRCN0000314851 GCCGTCAGAATTCAGAAACAA pLKO_005 1130 CDS 100% 0.000 0.000 N SYNM n/a
4 TRCN0000314855 TCGGAAAGCACACGGTCAAAT pLKO_005 1581 CDS 100% 13.200 7.920 N SYNM n/a
5 TRCN0000005123 GCTGAAGTCAACGTCTCACAA pLKO.1 3132 CDS 100% 4.950 2.970 N SYNM n/a
6 TRCN0000314852 GCTGAAGTCAACGTCTCACAA pLKO_005 3132 CDS 100% 4.950 2.970 N SYNM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022035.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.