Transcript: Human XM_017022235.2

PREDICTED: Homo sapiens neogenin 1 (NEO1), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NEO1 (4756)
Length:
5148
CDS:
192..4397

Additional Resources:

NCBI RefSeq record:
XM_017022235.2
NBCI Gene record:
NEO1 (4756)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022235.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118045 CCTTTGAATTAGTTCCGACTT pLKO.1 3049 CDS 100% 4.050 5.670 N NEO1 n/a
2 TRCN0000305584 AGTGTAGACATTGGCATTTAT pLKO_005 4749 3UTR 100% 15.000 10.500 N Neo1 n/a
3 TRCN0000305539 GGATGATGCTGGGACTTATTT pLKO_005 1127 CDS 100% 15.000 10.500 N Neo1 n/a
4 TRCN0000118043 CCCAGCAAACACCAAGTACAA pLKO.1 2900 CDS 100% 4.950 3.465 N NEO1 n/a
5 TRCN0000311635 CCCAGCAAACACCAAGTACAA pLKO_005 2900 CDS 100% 4.950 3.465 N NEO1 n/a
6 TRCN0000118046 CGGTGGATACACTCTCAGTTA pLKO.1 367 CDS 100% 4.950 3.465 N NEO1 n/a
7 TRCN0000349396 CGGTGGATACACTCTCAGTTA pLKO_005 367 CDS 100% 4.950 3.465 N NEO1 n/a
8 TRCN0000118042 GCATCACCTTTATGGAGTGTA pLKO.1 4734 3UTR 100% 4.950 3.465 N NEO1 n/a
9 TRCN0000311710 GCATCACCTTTATGGAGTGTA pLKO_005 4734 3UTR 100% 4.950 3.465 N NEO1 n/a
10 TRCN0000118044 GCCCAACTGATAATCCTTGAA pLKO.1 1458 CDS 100% 4.950 3.465 N NEO1 n/a
11 TRCN0000311634 GCCCAACTGATAATCCTTGAA pLKO_005 1458 CDS 100% 4.950 3.465 N NEO1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022235.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.