Transcript: Human XM_017022283.1

PREDICTED: Homo sapiens S-phase cyclin A associated protein in the ER (SCAPER), transcript variant X22, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SCAPER (49855)
Length:
6307
CDS:
217..2802

Additional Resources:

NCBI RefSeq record:
XM_017022283.1
NBCI Gene record:
SCAPER (49855)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022283.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431005 GCATACAGAAAGGTCAATTTG pLKO_005 1145 CDS 100% 13.200 18.480 N SCAPER n/a
2 TRCN0000161016 GCCCAGAATAAACGTCATGAT pLKO.1 2116 CDS 100% 4.950 3.960 N SCAPER n/a
3 TRCN0000159405 GCAGTAGATGAAATCTATGTA pLKO.1 553 CDS 100% 5.625 3.938 N SCAPER n/a
4 TRCN0000162917 GCAGACCAACATCATTGGCAT pLKO.1 707 CDS 100% 2.640 1.848 N SCAPER n/a
5 TRCN0000150972 CCACTCCTATTCAACATAGTA pLKO.1 4505 3UTR 100% 5.625 2.813 Y LOC401623 n/a
6 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 5976 3UTR 100% 4.950 2.475 Y ORAI2 n/a
7 TRCN0000161892 GCCTGTAATTCCAGCTACTTA pLKO.1 6034 3UTR 100% 5.625 2.813 Y GPN2 n/a
8 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 6064 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022283.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.