Transcript: Human XM_017022304.1

PREDICTED: Homo sapiens spectrin beta, non-erythrocytic 5 (SPTBN5), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPTBN5 (51332)
Length:
7596
CDS:
27..7136

Additional Resources:

NCBI RefSeq record:
XM_017022304.1
NBCI Gene record:
SPTBN5 (51332)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022304.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427183 CCTCCAAAGTGTGGTCGTAAA pLKO_005 3248 CDS 100% 10.800 15.120 N SPTBN5 n/a
2 TRCN0000415973 GACTCATCTGGGTCATCATTC pLKO_005 532 CDS 100% 10.800 15.120 N SPTBN5 n/a
3 TRCN0000113910 CGGGAGAGTTTCCTTAAGGAT pLKO.1 1398 CDS 100% 3.000 4.200 N SPTBN5 n/a
4 TRCN0000431712 GACTTTGATCCCAACACTATA pLKO_005 2667 CDS 100% 13.200 9.240 N SPTBN5 n/a
5 TRCN0000113908 GCAGCTCAAATATGAGAACTT pLKO.1 2882 CDS 100% 4.950 3.465 N SPTBN5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022304.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.