Transcript: Human XM_017022526.1

PREDICTED: Homo sapiens tight junction protein 1 (TJP1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TJP1 (7082)
Length:
6911
CDS:
107..5464

Additional Resources:

NCBI RefSeq record:
XM_017022526.1
NBCI Gene record:
TJP1 (7082)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022526.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303907 GGAACCACTCTATCAAGTATT pLKO_005 5520 3UTR 100% 13.200 18.480 N TJP1 n/a
2 TRCN0000116252 GCAATAAAGCAGCGTTTCTAT pLKO.1 6561 3UTR 100% 5.625 7.875 N TJP1 n/a
3 TRCN0000116253 GCGATCTCATAAACTTCGTAA pLKO.1 2374 CDS 100% 4.950 6.930 N TJP1 n/a
4 TRCN0000300284 GCGATCTCATAAACTTCGTAA pLKO_005 2374 CDS 100% 4.950 6.930 N TJP1 n/a
5 TRCN0000303972 TCGATTGGCAAGCCATATATT pLKO_005 706 CDS 100% 15.000 12.000 N TJP1 n/a
6 TRCN0000303971 CAAGAGAAGAACCAGATATTT pLKO_005 2091 CDS 100% 15.000 10.500 N TJP1 n/a
7 TRCN0000303909 CCATGCAGAGAAGCCTAAATA pLKO_005 4942 CDS 100% 15.000 10.500 N TJP1 n/a
8 TRCN0000116254 CCTGCATACAATAAAGCAAAT pLKO.1 2176 CDS 100% 10.800 7.560 N TJP1 n/a
9 TRCN0000116255 CGACCATTTGAACGCAAGTTT pLKO.1 4766 CDS 100% 5.625 3.938 N TJP1 n/a
10 TRCN0000116256 GCCTGCATACAATAAAGCAAA pLKO.1 2175 CDS 100% 4.950 3.465 N TJP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022526.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.