Transcript: Human XM_017022703.2

PREDICTED: Homo sapiens HECT and RLD domain containing E3 ubiquitin protein ligase family member 1 (HERC1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HERC1 (8925)
Length:
15287
CDS:
149..14824

Additional Resources:

NCBI RefSeq record:
XM_017022703.2
NBCI Gene record:
HERC1 (8925)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022703.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235497 CAGATTGTTGAGCGCTTATTT pLKO_005 6176 CDS 100% 15.000 21.000 N HERC1 n/a
2 TRCN0000235501 GACTGCTTTATGACCATATTA pLKO_005 1037 CDS 100% 15.000 21.000 N HERC1 n/a
3 TRCN0000235498 GAGCGCAAGCCATGATCTATA pLKO_005 8013 CDS 100% 13.200 18.480 N HERC1 n/a
4 TRCN0000235499 GTTCGAACTGGTCTAAGTTTA pLKO_005 632 CDS 100% 13.200 18.480 N HERC1 n/a
5 TRCN0000007246 GCATTCATTTACTCGAACTAT pLKO.1 4168 CDS 100% 5.625 7.875 N HERC1 n/a
6 TRCN0000007247 GCCATTGAATATCGACTTCAT pLKO.1 14297 CDS 100% 4.950 3.960 N HERC1 n/a
7 TRCN0000235500 TTAGTTGGGAATGGTACATTT pLKO_005 15108 3UTR 100% 13.200 9.240 N HERC1 n/a
8 TRCN0000007244 GCTGATAAACTGAGTCCCAAA pLKO.1 5729 CDS 100% 4.050 2.835 N HERC1 n/a
9 TRCN0000007245 GCCCAGAATATCACTGTCCTT pLKO.1 8585 CDS 100% 2.640 1.848 N HERC1 n/a
10 TRCN0000007243 GCCACATTTAGTTACTCTAAA pLKO.1 14949 3UTR 100% 1.320 0.924 N HERC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022703.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.