Transcript: Human XM_017022952.2

PREDICTED: Homo sapiens ZFP90 zinc finger protein (ZFP90), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZFP90 (146198)
Length:
4689
CDS:
89..2251

Additional Resources:

NCBI RefSeq record:
XM_017022952.2
NBCI Gene record:
ZFP90 (146198)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022952.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218382 ACTCTAGGAACCGTGAAATTA pLKO_005 2245 CDS 100% 15.000 21.000 N ZFP90 n/a
2 TRCN0000181178 CCAACCTGCATGATCATCAGA pLKO.1 2121 CDS 100% 3.000 4.200 N ZFP90 n/a
3 TRCN0000230392 ACATAATGCAGACTTACTTAA pLKO_005 919 CDS 100% 13.200 9.240 N ZFP90 n/a
4 TRCN0000230394 ATAGTTTGACAATGGGTAATT pLKO_005 4249 3UTR 100% 13.200 9.240 N ZFP90 n/a
5 TRCN0000218142 CATAGATCATCGCTTACTAAA pLKO_005 1004 CDS 100% 13.200 9.240 N ZFP90 n/a
6 TRCN0000230393 AGTAACTACAGCATAGATTTC pLKO_005 1613 CDS 100% 10.800 6.480 N ZFP90 n/a
7 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 3415 3UTR 100% 4.950 2.475 Y CFLAR n/a
8 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 3415 3UTR 100% 4.950 2.475 Y C19orf31 n/a
9 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 209 CDS 100% 0.495 0.248 Y C11orf44 n/a
10 TRCN0000016211 GCGAATTCACACTGGAGAGAA pLKO.1 1327 CDS 100% 0.000 0.000 Y ZNF2 n/a
11 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 1900 CDS 100% 13.200 6.600 Y Zfp977 n/a
12 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 3413 3UTR 100% 4.950 2.475 Y ERN2 n/a
13 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 3413 3UTR 100% 4.950 2.475 Y P3H4 n/a
14 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 3413 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022952.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.