Transcript: Human XM_017023200.2

PREDICTED: Homo sapiens zinc finger with KRAB and SCAN domains 2 (ZKSCAN2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZKSCAN2 (342357)
Length:
7520
CDS:
1434..3725

Additional Resources:

NCBI RefSeq record:
XM_017023200.2
NBCI Gene record:
ZKSCAN2 (342357)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023200.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107354 GATTTCGAGAACATCGGAGAA pLKO.1 3523 CDS 100% 4.050 5.670 N ZKSCAN2 n/a
2 TRCN0000107353 CGAAGCAACTACGTCAAGGAA pLKO.1 1725 CDS 100% 3.000 4.200 N ZKSCAN2 n/a
3 TRCN0000107351 GCGTTCTACAAGGAGATGGAT pLKO.1 2541 CDS 100% 3.000 4.200 N ZKSCAN2 n/a
4 TRCN0000426523 GGCTGAATGGTTGCGAGAATG pLKO_005 1952 CDS 100% 10.800 8.640 N ZKSCAN2 n/a
5 TRCN0000417940 ATGAAATAGGCATCGAATTTA pLKO_005 2239 CDS 100% 15.000 10.500 N ZKSCAN2 n/a
6 TRCN0000107352 CCGCAAATGCTTCAGGCAATT pLKO.1 942 5UTR 100% 10.800 7.560 N ZKSCAN2 n/a
7 TRCN0000429522 TTGCTAAGTTCGGCAACATTC pLKO_005 4004 3UTR 100% 10.800 7.560 N ZKSCAN2 n/a
8 TRCN0000107350 CCCAGTAAACACTGAAGGAAA pLKO.1 5065 3UTR 100% 4.950 3.465 N ZKSCAN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023200.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10035 pDONR223 100% 78.1% 76.8% None 0_1ins623;53_63del;1233A>T n/a
2 ccsbBroad304_10035 pLX_304 0% 78.1% 76.8% V5 0_1ins623;53_63del;1233A>T n/a
Download CSV