Transcript: Human XM_017023235.2

PREDICTED: Homo sapiens MAF bZIP transcription factor (MAF), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAF (4094)
Length:
11057
CDS:
2051..3202

Additional Resources:

NCBI RefSeq record:
XM_017023235.2
NBCI Gene record:
MAF (4094)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023235.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272495 TGTTAATGACTTCGATCTGAT pLKO_005 2113 CDS 100% 4.950 6.930 N MAF n/a
2 TRCN0000193202 CGATCTGATGAAGTTTGAAGT pLKO.1 2125 CDS 100% 4.950 3.960 N Maf n/a
3 TRCN0000175240 CTGATGAAGTTTGAAGTGAAA pLKO.1 2129 CDS 100% 4.950 3.465 N Maf n/a
4 TRCN0000000258 TGGAAGACTACTACTGGATGA pLKO.1 2313 CDS 100% 4.050 2.835 N MAF n/a
5 TRCN0000272496 TGGAAGACTACTACTGGATGA pLKO_005 2313 CDS 100% 4.050 2.835 N MAF n/a
6 TRCN0000000257 ACCTGGAAGACTACTACTGGA pLKO.1 2310 CDS 100% 2.640 1.848 N MAF n/a
7 TRCN0000000256 ACAAGGAGAAATACGAGAAGT pLKO.1 3081 CDS 100% 4.950 2.475 Y MAF n/a
8 TRCN0000000255 CAAGGAGAAATACGAGAAGTT pLKO.1 3082 CDS 100% 4.950 2.475 Y MAF n/a
9 TRCN0000193799 CAAGGAGAAATACGAGAAGCT pLKO.1 3082 CDS 100% 2.640 1.320 Y Maf n/a
10 TRCN0000423501 CAAGGAGAAATACGAGAAGCT pLKO_005 3082 CDS 100% 2.640 1.320 Y MAFA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023235.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.