Transcript: Human XM_017023242.1

PREDICTED: Homo sapiens ATP binding cassette subfamily C member 1 (ABCC1), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ABCC1 (4363)
Length:
6089
CDS:
4..4308

Additional Resources:

NCBI RefSeq record:
XM_017023242.1
NBCI Gene record:
ABCC1 (4363)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023242.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059363 CCTCTCTGTTTAAGGTGTTAT pLKO.1 989 CDS 100% 13.200 18.480 N ABCC1 n/a
2 TRCN0000059365 CCACATGAAGAGCAAAGACAA pLKO.1 1536 CDS 100% 4.950 3.465 N ABCC1 n/a
3 TRCN0000286611 CCACATGAAGAGCAAAGACAA pLKO_005 1536 CDS 100% 4.950 3.465 N ABCC1 n/a
4 TRCN0000059366 CCTCTCAGTGTCTTACTCATT pLKO.1 3405 CDS 100% 4.950 3.465 N ABCC1 n/a
5 TRCN0000286679 CCTCTCAGTGTCTTACTCATT pLKO_005 3405 CDS 100% 4.950 3.465 N ABCC1 n/a
6 TRCN0000059364 CCTGGGCTTATTTCGGATCAA pLKO.1 3723 CDS 100% 4.950 3.465 N ABCC1 n/a
7 TRCN0000311764 CCTGGGCTTATTTCGGATCAA pLKO_005 3723 CDS 100% 4.950 3.465 N ABCC1 n/a
8 TRCN0000294041 TCTACCAGGAACGCTTCATTT pLKO_005 4778 3UTR 100% 13.200 7.920 N ABCC1 n/a
9 TRCN0000244863 TGGACTTGGCCACGTACATTA pLKO_005 1361 CDS 100% 13.200 7.920 N Abcc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023242.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.