Transcript: Human XM_017023656.2

PREDICTED: Homo sapiens FTO alpha-ketoglutarate dependent dioxygenase (FTO), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FTO (79068)
Length:
1834
CDS:
43..1419

Additional Resources:

NCBI RefSeq record:
XM_017023656.2
NBCI Gene record:
FTO (79068)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023656.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246249 CGGTTCACAACCTCGGTTTAG pLKO_005 975 CDS 100% 10.800 15.120 N FTO n/a
2 TRCN0000255403 ACCTGAACACCAGGCTCTTTA pLKO_005 365 CDS 100% 13.200 9.240 N FTO n/a
3 TRCN0000246250 TCACCAAGGAGACTGCTATTT pLKO_005 909 CDS 100% 13.200 9.240 N FTO n/a
4 TRCN0000255404 TCTCGCATCCTCATTGGTAAT pLKO_005 325 CDS 100% 10.800 6.480 N FTO n/a
5 TRCN0000257473 GCCAGTGAAAGGGTCTAATAT pLKO_005 396 CDS 100% 15.000 7.500 Y FTO n/a
6 TRCN0000255402 CAACGTAACTTTGCTGAATTT pLKO_005 639 CDS 100% 13.200 6.600 Y FTO n/a
7 TRCN0000165774 CCTCCTAAGTAGCTGGGATTA pLKO.1 1673 3UTR 100% 10.800 5.400 Y SNX29P1 n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1811 3UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1811 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023656.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.