Transcript: Human XM_017023731.1

PREDICTED: Homo sapiens chromosome 16 open reading frame 70 (C16orf70), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C16orf70 (80262)
Length:
1375
CDS:
165..947

Additional Resources:

NCBI RefSeq record:
XM_017023731.1
NBCI Gene record:
C16orf70 (80262)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023731.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433452 TCCAAAGTATGAGCCCAATTT pLKO_005 602 CDS 100% 13.200 18.480 N C16orf70 n/a
2 TRCN0000425620 ATGATGCCTCTGAGCTGTTTC pLKO_005 720 CDS 100% 10.800 7.560 N C16orf70 n/a
3 TRCN0000423853 TGACTCAGGACGGGATCAAAC pLKO_005 343 CDS 100% 10.800 7.560 N C16orf70 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023731.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04198 pDONR223 100% 58.1% 55.3% None (many diffs) n/a
2 ccsbBroad304_04198 pLX_304 0% 58.1% 55.3% V5 (many diffs) n/a
3 TRCN0000480083 GCGGAGGCGCGCTACTGTGAGAAA pLX_317 27.3% 58.1% 55.3% V5 (many diffs) n/a
Download CSV