Transcript: Human XM_017023820.1

PREDICTED: Homo sapiens calcium voltage-gated channel subunit alpha1 H (CACNA1H), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CACNA1H (8912)
Length:
5301
CDS:
95..5170

Additional Resources:

NCBI RefSeq record:
XM_017023820.1
NBCI Gene record:
CACNA1H (8912)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023820.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426973 ACGTCTTCACCATCGTGTTTG pLKO_005 5132 CDS 100% 10.800 7.560 N CACNA1H n/a
2 TRCN0000044209 GCACTGAAGCTGGTAGCATTT pLKO.1 5164 CDS 100% 10.800 7.560 N CACNA1H n/a
3 TRCN0000044210 CCTCAGCGTCTCCAATTACAT pLKO.1 4075 CDS 100% 5.625 3.938 N CACNA1H n/a
4 TRCN0000331243 CCTCAGCGTCTCCAATTACAT pLKO_005 4075 CDS 100% 5.625 3.938 N CACNA1H n/a
5 TRCN0000044211 CCACATATTCCGCAAGGTCAA pLKO.1 1489 CDS 100% 4.050 2.835 N CACNA1H n/a
6 TRCN0000300511 CCACATATTCCGCAAGGTCAA pLKO_005 1489 CDS 100% 4.050 2.835 N CACNA1H n/a
7 TRCN0000044208 GCTGACTAATGCTCTGGAGAT pLKO.1 2554 CDS 100% 4.050 2.835 N CACNA1H n/a
8 TRCN0000218435 AGTACTGCAACTACGTCTTTA pLKO_005 5120 CDS 100% 13.200 10.560 N Cacna1h n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023820.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.