Transcript: Human XM_017023900.2

PREDICTED: Homo sapiens meiosis regulator and mRNA stability factor 1 (MARF1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MARF1 (9665)
Length:
5887
CDS:
89..5320

Additional Resources:

NCBI RefSeq record:
XM_017023900.2
NBCI Gene record:
MARF1 (9665)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023900.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245338 TCAGACGCCTGTCCGATAATT pLKO_005 1683 CDS 100% 15.000 21.000 N MARF1 n/a
2 TRCN0000245341 GTCGTGAAGGTTGCCGATATA pLKO_005 4265 CDS 100% 13.200 18.480 N MARF1 n/a
3 TRCN0000245339 GTGCAATTCTCCGCTTCATAA pLKO_005 1737 CDS 100% 13.200 18.480 N MARF1 n/a
4 TRCN0000245340 TTGAATGTGTCAGATCTATAT pLKO_005 2825 CDS 100% 13.200 18.480 N MARF1 n/a
5 TRCN0000061920 CGCTTTACTCAGGATTTACTA pLKO.1 3623 CDS 100% 5.625 7.875 N MARF1 n/a
6 TRCN0000245342 ACTGGTGTTTCCGACAGTATT pLKO_005 5735 3UTR 100% 13.200 10.560 N MARF1 n/a
7 TRCN0000061921 CCTCCAATCTGCTGATCTCAT pLKO.1 5023 CDS 100% 4.950 3.465 N MARF1 n/a
8 TRCN0000061922 CCTTCTTACCATCACCACTTT pLKO.1 3947 CDS 100% 4.950 3.465 N MARF1 n/a
9 TRCN0000061918 GCCCAGTTTGTTAAACTCCTT pLKO.1 4112 CDS 100% 2.640 1.848 N MARF1 n/a
10 TRCN0000061919 GCAAAGAATGTGCGGTCTTTA pLKO.1 4562 CDS 100% 1.320 0.924 N MARF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023900.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.